Re: [pbmserv] New game: DNA

[ray@gofaster.plus.com]

Would a command to initialise your code with a random sequence be useful?
Maybe even a game option to set random codes for all players.

> Hi,
>
> A new game DNA has been added to the server. Players whittle away at
> their opponents' genetic code in order to delete them from existence.
>
> PBeM help page: http://www.gamerz.net/pbmserv/dna.html
> Web graphics: http://www.gamerz.net/pbmserv/List.php?Dna
>
> Usage:
>    dna challenge <you> camb
>
> I'd be interested in some multiplayer games.
>
> Cameron (camb)
>
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> Help for the Game of DNA
>
>     Welcome to the network DNA server. The challenge command is described
> here.
>     Other commands are the same as for all pbmserv games.
>
>       dna challenge [-length=number] [-chunk=number] [-manual]
>           userid1 userid2 .. userid8
>
>     starts a new game for two to eight players players.
>
>     The -length parameter specifies the DNA sequence length (default 36).
>     The  -chunk parameters specify the size of the chunk removed each turn
>     (default 3).
>     The -manual option allows players to manually set their own sequences.
>
>    Introduction
>
>     DNA is a game of accelerated evolution: whittle down your
> opponents' genetic code before they whittle down yours!
>
>    Rules
>
>     Each player starts with a DNA sequence of 36 randomly generated
> nucleotides
>     labelled  A,  C,  G  and  T  for adenine, guanine, cytosie and thymine
>     respectively.
>
>     Players take turns nominating a chunk of three consecutive nucleotides
>     contained in their sequence. All instances of that chunk are removed
> from
>     their  sequence  and  all  opponents'  sequences.  Chunks  are removed
>     left-to-right with the remainder of the sequence collapsing down
> to fill the
>     gap; this operation is repeated until no more chunks are removed,
> hence
>     multiple removals are possible.
>
>     During the first round of play, the first player may remove at most
> one
>     chunk from any opponent, the second player may remove at least two
> chunks
>     from any opponent, and so on.
>
>     Players whose sequence length falls below the chunk size are removed
> from
>     the game; the last surviving player wins. If the sequence length of
> all
>     players falls below the chunk size then the game is won by the player
> with
>     the longest sequence, else the game is a tie for equal sequence
> length.
>
>    Example
>
>     For example, the following figure shows a game between ned, ted and
> jed.
>
>     ned (36): TCGCATGTACAAAGTTTTCAATCTTCGCCTTGAGAG
>     ted (36): TCAGCGCGTTCCCGGAGTCGTCGTATTAAAGGGGAT
>     jed (36): GCCAATTATGGACTTGTTGTCAGATAGTTTCCGGCG
>
>     As first move, ned might nominate the chunk AAG which occurs once in
> their
>     sequence as well ted's, giving the following results once these chunks
> are
>     removed (ned could not have nominated TTG on the first move as that
> chunk
>     occurs twice in jed's sequence):
>
>     ned (33): TCGCATGTACATTTTCAATCTTCGCCTTGAGAG
>     ted (33): TCAGCGCGTTCCCGGAGTCGTCGTATTAGGGAT
>     jed (36): GCCAATTATGGACTTGTTGTCAGATAGTTTCCGGCG
>
>     As second move, ted might nominate TTC whose removal gives the
> following
>     results:
>
>     ned (27): TCGCATGTACATTAATCGCCTTGAGAG
>     ted (30): TCAGCGCGCCGGAGTCGTCGTATTAGGGAT
>     jed (33): GCCAATTATGGACTTGTTGTCAGATAGTCGGCG.
>
>    Notes
>
>     Cchunk  removal may be nested and not necessarily straightforward. For
>     example, the chunk AGC only occurs once in the sequence TAAGAAGCGCCT
> but
>     consider what happens as it is removed:
>
>       TAAGA[AGC]GCCT  -->  TAAG[AGC]CT  -->  TA[AGC]T  -->  TAT
>
>     Chunks may be selected strategically to break dangerous formations in
> your
>     own sequence or to manipulate opponents' sequences to encourage them
> to
>     attack other opponents. For example, ned might nominate a sequence
> whose
>     removal causes ted's sequence to form a chunk that's disastrous for
> jed.
>
>     In multiplayer games, there is therefore a balance between hurting
> your
>     opponents (especially the next player in turn, who you have the
> greatest
>     control over) and helping them hurt others. Spread the hurt around!
>
>     Only one strand of each player's double helix is shown as that
> strand's
>     sequence implies the sequence on the other strand (unless you have
> eleven
>     toes).
>
> Test Options
>
>     The -min_chunk parameter specifies the minimum chunk size (must be at
> least
>     2).
>     The  -max_chunk parameter specifies the maximum chunk size. Chunks may
>     therefore range in size within each game (e.g. 2..4).
>     The -non_incremental option removes the incremental first round limit
> on
>     chunk removal.
>     The -need_not_own option specifies that players need not own a chunk
> to
>     nominate it.
>     The -no_reduce_self option specifies that players do not remove chunks
> from
>     their own sequence.
>     The -reduce_next option specifies that players remove chunks from the
> next
>     opponent but not other opponents.
>
> Syntax
>
>     Remove chunk GGT:
>       dna move board# userid password GGT
>
>     Manually set sequence to GCCAATTATGGACTTGTTGTCAGATAGTTTCCGGCG:
>       dna move board# userid password GCCAATTATGGACTTGTTGTCAGATAGTTTCCGGCG
>
>     Alternatively, simply spit on your keyboard to trigger the
> auto-gene sequencer and
>     start the game with your own unique DNA sequence!*
>
>     *Not implemented yet.
>
>    History
>
>     DNA rules by Cameron Browne, copyright (c) Cyberite Ltd 2008.
>
>     Graphical web interface: http://www.gamerz.net/pbmserv/Dna.php?Dna
>
>     Implementation and Help file by Cameron Browne, October 2008.
>
>
> To unsubscribe, send a message to esquire@gamerz.net with
> 	unsubscribe pbmserv-users@gamerz.net
> as the BODY of the message.  The SUBJECT is ignored.
>
>